Progress 09/01/10 to 08/31/13
Outputs
Target Audience: Students, homeowners, palm growers, landscape professionals, county extension agents in Florida Changes/Problems:
Nothing Reported
What opportunities for training and professional development has the project provided?
Nothing Reported
How have the results been disseminated to communities of interest? Descriptions of phytoplasma disease of palms and a protocol for nondestructively sampling palms for the purpose of phytoplasma disease diagnosis by DNA-based molecular methods are made publicly available on the University of Florida/IFAS Fort Lauderdale Research and Education Centers' Home Page by following the listed link to Plant Pathology. Information about palm phytoplasma diseases presented to attendees as part of a 2 day workshop, 'Palm Management in the Florida Landscape' presented twice yearly at the University of Florida's Fort Lauderdale Research and Education Center. What do you plan to do during the next reporting period to accomplish the goals?
Nothing Reported
Impacts
What was accomplished under these goals?
A protocol for acquiring tissue samples and DNA extracts for use DNA-based diagnostics to detect the Texas Phoenix palm phytoplasma (subgroup 16SrIV-D) was developed. The sensitivity of a LAMP assay employing primers IV2-F3 (AAGATTTTAAGGGCCTATAGCTCAGT); IV2-B3 (CCATGACGTATCGCCGTTAA); IV2-FIP (TGATTTTCAGTACATTTAGACTGGTGGGTTAGA GCACACGCCTGATAAG); IV2-BIP (ATTCTCAAAAT AATGAGGAAAATAAGGGGCGTCCTTCATCGGCTCT); IV2-FL (GGACTTGAACCACCGACCTC) and IV2-BL (GTACAGTGGATGCCTTGGCA), a TaqMan real-time polymerase chain reaction (PCR) assay employing primers LY16S-LSF (5’-GCTAAAGTC CCCACCATAACGT-3’)/ LY16S-LSR (5’-CGTGTCGTGAGATGTTAGGTTAAGT-3’) and probe (FAM-CC CCTGTCGTTAATTG-NFQ), were compared with a PCR assay employing phytoplasma group 16SrIV-specific rrn operon primers P1m/LY16-23Sr followed by LY16Sf2/LY16-23Sr2 during this project. Results from analysis of 10-fold serial dilutions of DNAs from diseased stem tissues determined the LAMP assay to be 10-fold less sensitive than nested PCR or real-time PCRs both of which were comparable in sensitivity and capable of detecting phytoplasma DNA in 10-1 pg of diseased palm DNA extracts. Samples from 316 declining palms comprising 16 species were solicited from Florida palm growers, landscaping services, homeowners and UF/IFAS Cooperative Extension personnel for TPPD analysis The majority of samples (210) were derived from Phoenix species, S. palmetto (40), Cocos nucifera (27) and Washingtonia robusta (12). Samples were analyzed by nested PCRs. At least one sample from a total of 16 Florida counties (Alachua, Charlotte, Collier, De Soto, Duval, Hardee, Highlands, Hillsborough, Indian River, Lake, Lee, Manatee, Orange, Palm Beach, Polk and Sarasota) tested positive for TPPD. Monthly monitoring of sabal palm population in a 458-acre county park located in coastal Hillsborough County, was used to assess incidence and spread of TPPD. During 2010-2011, 41 new cases of disease were documented, with at least one new case of disease each month. New cases peaked in March (10 cases), and again in August (9 cases). Twenty three of 41 (56%) palms containing subgroup 16SrIV-D phytoplasmas (TPPD) were confirmed. In 2011-2012, 31 further cases were recorded. At least one newly diseased palm was observed each month. New cases peaked in abundance in February-March, with a total of 19 palms. Seventeen of 31 (55%) cases were attributed to TPPD by PCRs. Failure to detect phytoplasmas in samples due to inhibitors was discounted in all phytoplasma negative samples following evaluation of all negatives by a TaqMan real-time PCR assay with universal primers rbcL-F (5’-TTGGCAGCATTCCGAGTAACTCCT-3’)/ rbcL-R (5’-TCCATCAGTCCACACAGTTGTCCA-3’) and probe VIC-AGCGGTAGCTGCCGAATCTTCTACT-NFQ designed from sequences of the palm plastid gene rbcL (ribulose-1,5 biphosphate carboxylase). Multi-locus sequencing typing and RFLP analysis of PCR products was used to assess the TPPD pathogen for evidence of strain variants. Nested primer groF1 (5’-GATAATGCTGGGAGATGGGACTACT-3’)/groR1 (5’-GAACTACAGCGGCTCC TGTTGTAAT-3’) and groF2 (5’-TGGGAGATGGGACTACTACTGCAACTGTTT-3’)/groR2 (CAGCGGCTCCTGTTGTAATTATAACAGAAG), as well as nested primer pairs fusF1 (5’-GCTCATATTGATGCTGGTAAAAC-3’)/fusR1 (5’-TCTAAATGTAATTCGCCCATTCC-3’) and fusF2 (5’-GATGCTGGTAAAACAACTACAACAGAAAG-3’)/fusR2 (5’-AAAATACGTC CAACTCGTTCTCTAATG-3’) were used to amplify 1.3 kb and 1 kb portions of the groEL and fusA genes, respectively. Both assays detected subgroup 16SrIV-D and A strains with equal sensitivity. RFLP analysis of groEL fusA gene amplicons failed to detect polymorphisms among subgroup 16SrIV-D strains in sabals or other palms although RFLP patterns for both genes distinguished these strains from subgroup 16SrIV-A phytoplasmas. Monthly live collections of insects from foliage within E.G. Simmons Park and adjacent property revealed the fulgorids, Ormenaria rufifascia (Flatidae), Haplaxius crudus (Cixiidae) and Omolicna joi (Derbidae), that were consistently associated with sabals and a Cyarda sp. (Flatidae)was most numerous on understory plants. O. rufifascia, exhibits a monophagous association with and was found on sabals only with peak abundance of nymphs and adults occurring in April-June annually. H. crudus and O. joi were found on palms in low abundance and incidental captures of both species peaked in May-July coinciding with peak captures of Cyarda sp. With rare exceptions, insects were collected from symptomless palms in close proximity to diseased palms. Analysis of head capsules and salivary glands removed from individuals of all four species failed to yield any phytoplasma positive results. A total of 1300 sequences were obtained by cloning products of DOP-PCRs from sabal palm (Sabal1) DNA. Cloned amplicons (340) >300 bp in size were sequenced and 245 (245/340; 72%) produced unique sequences. LS-primers were developed from 69 unique sequences, and 36 of these were analyzed by PCR assay. Of these, 66% (24/36) amplified an appropriate sized insert. Screening individual S. palmetto accessions from the Montgomery Botanical Center (MGC) (http://www.montgomerybotanical.org/) germplasm collection, identified the most informative LS-primers. Of 24 LS-primer pairs 5 pairs consistently amplified DNA products. Of these, primers 2C17F/R, 2C153F/R and 4C14F/R amplified the products from the majority of MGC sabal palm accessions. For the genetic diversity analyses, DnaSP version 5 (http://www.ub.edu/dnasp/) was used to determine population haplotypes, polymorphic site data, nucleotide diversity, haplotype diversity (h) and the average number of nucleotide differences (k) for overall sequences for each of the polymorphic primer pairs. Tests for neutrality (Tajima’s D statistic) was performed in DnaSP version 5. Analysis of molecular variance (AMOVA), to test population differentiation, was conducted in ARLEQUIN ver. 3.5. For primers 1C3 (putative subtilisin-like, protease-like mRNA) 18 sequences were obtained, resulting in 8 different haplotypes and 39 polymorphic sites. Arlequin results indicated that the overall population was low in genetic diversity, occurring mostly within populations. Pairwise comparison showed a significant difference between Miami-Dade County and Long Island (Bahamas) populations only. For 1C7 primers (putative fosmid genomic sequence), 22 sequences were obtained resulting in 6 different haplotypes and 9 polymorphic sites. Arlequin results indicated that the overall population had significant genetic diversity among and within populations. Pairwise comparison showed a significant difference between Broward and Levy County, Broward and Long Island, and Levy County and Hillsborough County populations only. For primers 2C17 (putative glycine max proline-rich receptor-like protein kinase), 36 sequences were obtained that included 5 different haplotypes and 6 polymorphic sites. Arlequin results indicated low genetic diversity in the overall population, and most variation within populations. Pairwise comparison revealed a significant difference between Abacos (Bahamas) and St. Johns County populations only. For primers 2C153 (putative ruBisCO large subunit-binding protein subunit alpha), 46 sequences resulted in 11 different haplotypes and 8 polymorphic sites. Arlequin results indicated the overall population had a low but significant genetic diversity, mostly within populations. Significant differences were found between Lake and Seminole county populations compared with those of Abacos, Eleuthera (Bahamas), Gulf, Levy, Orange, St Johns and Hillsborough county samples; and between Eleuthera compared with Long Island (Bahamas) and Hillsborough populations.
Publications
- Type:
Journal Articles
Status:
Published
Year Published:
2012
Citation:
Ntushelo, K., Harrison, N. A. and M. L. Elliott. 2012. Comparison of the ribosomal RNA operon from Texas Phoenix decline and lethal yellowing phytoplasmas. European Journal of Plant Pathology 33: 779-782.
- Type:
Book Chapters
Status:
Published
Year Published:
2013
Citation:
Harrison, N. A., Davis, R. E. and E. E. Helmick. 2013. DNA Extraction from arborescent monocots and how to deal with other challenging hosts. Chapter 13, Pages 147-158, In: Phytoplasma Methods and Protocols. Dickinson, M. and Hodgetts, J.,eds. Humana Press, Springer, NY.
- Type:
Journal Articles
Status:
Published
Year Published:
2013
Citation:
Ntushelo, K., Harrison, N. A. and Elliott, M. L. 2013. Differences between the Texas phoenix palm phytoplasma and the coconut lethal yellowing phytoplasma revealed by restriction fragement length polymorphism (RFLP) analysis of the NUSA and HFLB genes. African Journal of Biotechnology Vol. 12(25), pp. 3934-3939.
- Type:
Journal Articles
Status:
Published
Year Published:
2013
Citation:
Ntushelo, K., Harrison, N. A., and Elliott, M. L. 2013. Palm phytoplasmas in the Caribbean basin. Palms 57: 93-100.
- Type:
Journal Articles
Status:
Published
Year Published:
2013
Citation:
Ntushelo, K., Harrison , N. A. and Elliott, M. L. 2013. Molecular survey of the Texas Phoenix decline phytoplasma population in Florida, USA. African Journal of Biotechnology, Vol.12: 5814-5822.
- Type:
Other
Status:
Published
Year Published:
2012
Citation:
Harrison, N. A. 2012. Palm Lethal Yellowing Phytoplasma (Lethal Yellowing of Coconut) Datasheet. Crop Protection Compendium, CAB International, Wallingford, UK.
- Type:
Other
Status:
Published
Year Published:
2012
Citation:
Harrison, N. A. 2012. Candidatus Phytoplasmas palmae and related strains datasheet. USDA/APHIS//PPQ/CPHS.
|
Progress 09/01/11 to 08/31/12
Outputs
OUTPUTS: A survey of native sabal palms (Sabal palmetto) for cases of phytoplasma associated lethal decline disease was begun in November, 2010 at E.G. Simmons regional park (458 acres) located on the southwestern coastline of Hillsborough county, Florida. Mortality to disease began at this site in 2008 and continues. At the start of the survey, 60 dead palms and 11 mature palms with suspected symptoms, along with their respective GPS coordinates within the park, were identified and documented. Tissues (3 g) excised from the lower stems of each suspect palm were used for DNA extraction. Resulting DNA samples were analyzed by a nested PCR assay employing lethal yellowing group (16SrIV)-specific rRNA operon primer pairs to confirm phytoplasma infection. Continued monthly monitoring of the park has confirmed 41 new cases of disease in 2011. Subgroup 16SrIV-D phytoplasmas were detected in all diseased palms based upon RFLP analysis of PCR products. At least one new case of disease was recorded per month with peak palm mortality occurring in March (10 new cases), and in August (9 new cases), respectively. Disease expression accelerated during February-March as evidenced by advanced stage foliar symptoms on all newly affected palms in March. Comparable advanced symptoms developed on all other affected palms over a 2-3 month interval for the remainder of the year. Lack of mortality among 64 mature sabal palms treated by stem injection with oxytetracycline hydrochloride (OTC) every four months confirmed that OTC administered proactively is effective in suppressing disease spread among this palm species. Live capture collections confirmed Haplaxius crudus (Cixiidae), Ormenaria rufifascia (Flatidae) and Omolicna fulva (Derbidae) to be the most common sap-feeding insect species associated with sabal palms. Differences in abundance and seasonal occurrence of these species were noted. O. rufifascia was the most numerous on sabals with peak abundance in April-June but was absent from palms from October-March. By comparison, O. fulva and H. crudus were far less numerous. Both were captured throughout the summer. O. fulva was most abundant in September whereas H. crudus was consistently present in low numbers on palms throughout the year. In a related study, subgroup 16SrIV-D phytoplasmas were detected by PCR assay in 18 of 21 Mexican fan palm (Sabal mexicana) and a solitary Buccaneer palm (Pseudophoenix sargentii) showing evidence of leaf decay and leaf yellowing syndromes, respectively, at 4 locations in Yucatan State, Mexico. A 16S rDNA product (1.4 kb) was obtained exclusively from 18 of 21 diseased S. mexicana and from the P. sargentii palm by a nested PCR assay employing phytoplasma universal rRNA gene primer pair P1/P7 followed by 16SrIV group specific primer pair LY16Sf/LY16Sr. Phytoplasma was determined by RFLP profiling of 16S rDNA products with endonucleases AluI, HhaI and HinfI which implicated the involvement of phytoplasmas belonging to group 16SrIV. In one S. mexicana palm, fragment patterns mathed that of a subgroup 16SrIV-A strain, while all other affected palms contained subgroup 16SrIV-D phytoplasmas. PARTICIPANTS: PARTICIPANTS: Robert E. Davis, Director of the Molecular Plant Pathology Laboratory, USDA ARS Beltsville, Maryland is providing assistance with the development of a loop-mediated isothermal amplification assay specific for subgroup 16SrIV-D phytoplasmas. Monica Elliott, Professor, at the University of Florida's Fort Lauderdale Research and Education Center solicited grower and community cooperation in order to obtain samples from diseased plants for molecular analysis and then subsequently coordinated disease survey work to procure disease incidence data. Ericka Helmick, a state-funded biological scientist, and Raphael Gonzalez, a grant funded technician at the University of Florida's Fort Lauderdale Research and Education Center provided all of the technical assistance needed to perform disease survey work, mapping and molecular diagnostics. Susan Halbert, an entomologist at the Florida Division of Plant Industry provided help with collection and identification of candidate insect vectors of the subgroup 16SrIV-D phytoplasma associated with diseased sabal palms. Rob Northrop and Margaret Dessaint at the University of Florida's Cooperative Extension Service in Hillsborough and Manatee counties, respectively, have provided continuing assistance in locating diseased palms and in conducting surveys and collections of potential vectors insects for identification and laboratory analysis. TARGET AUDIENCES: TARGET AUDIENCES: Nursery growers of palms especially in Florida. Managers, staff and private contractors charged with maintaining the health of residential community landscapes especially in Florida. Organizations charged with plant health, plant improvement and the international transfer of plant genetic resources. PROJECT MODIFICATIONS: Nothing significant to report during this reporting period.
Impacts
A year long survey of sabal palms reaffirmed both Hillsborough and Manatee counties of west-central Florida as the epicenter of lethal decline disease of sabal palms attributed to subgroup 16SrIV-D phytoplasmas. While local spread of the disease continues in both counties, the majority of sabals remain unaffected. Long distant dispersal and establishment of new active foci of disease in adjacent counties did not occur during 2011 suggesting that large scale, far reaching mortality of this species is unlikely to develop in Florida in the near future. Whether the basis for the current pattern of disease spread and mortality is correlated with either seasonal fluctuations in populations and behavior of insect vectors, or to variations in the genetic composition and susceptibility of sabal palm populations remains to be resolved. While prompt removal of diseased palms displaying early stage disease symptoms may prove to be an important management strategy to control spread of disease, monthly visual assessements alone failed to identify reliable early stage foliar symptoms indicative of phytoplasma disease on this species. The appearance of symptoms which begin on the oldest (lowermost) leaves were found to be effectively masked by discoloration of older leaves due to nutritional deficiency. Similarly, premature shedding of most or all fruit from infructescences, a reliable early symptom of phytoplasma disease on many susceptible palm species, was revealed to be an inconsistent symptom of disease development and available for observation on mature, affected sabal palms during the fall months only. As such prompt disease identification based on visual assessment alone is likely to have minimal impact on disease control, placing a premium on development of sensitive DNA-based diagnostics and sample extraction protocols for this purpose, which continue. In the interim, spread of disease among sabal palms was effectively suppressed by proactive treatments with tetracycline antibiotic (OTC) thereby confirming that such treatment offer a cost effective means for disease control, but only in relatively confined settings such as ornamental landscape and amenity plantings.
Publications
- Vazquez-Euan, R., Harrison, N., Narvaez, M. and Oropeza, C. 2011. Occurrence of a 16SrIV group phytoplasma not previously associated with palm species in Yucatan, Mexico. Plant Disease 95: 256-262.
|
Progress 09/01/10 to 08/31/11
Outputs
OUTPUTS: The locations of mature sabal palms (Sabal palmetto) exhibiting early, mid- and late stage foliar symptoms indicative of lethal decline, a newly emerging disease in Florida, were mapped within the confines of EG Simmons park in western Hillsborough county for continued study. Interior tissues were removed from the lower stems or the stem apex of the symptomatic palms were assessed for phytoplasma DNA by a nested polymerase chain reaction (PCR) assay employing rRNA gene operon primer pairs P1m/LY16-23Sr followed by LY16Sf2/LY16-23Sr. Phytoplasmas previously classified as rDNA RFLP group 16SrIV (lethal yellows) subgroup D were detected exclusively in all symptomatic palms. To reduce the time required to analyze palm DNA samples by PCRs, loop-mediated isothermal amplification (LAMP) assays employing primer sets derived from the 16-23S rRNA intergenic spacer (IGS) region and adjacent 23S rRNA gene of a subgroup 16SrIV-A strain were used to reassess lethal yellowing affected coconut and sabal palm DNA samples. With few exceptions, LAMP assay results approximated those obtained from these samples by nested PCRs and detected both subgroup 16SrIV-A and 16SrIV-D strains associated with equal efficiency. For DNAs derived from the stem apex (heart tissues) of coconut and sabal palms following extraction of fresh tissues by a phytoplasma enrichment protocol, LAMP assays consistently yielded positive detections when 2 to 10 nanongrams of DNA (estimated by fluorometry) was included as template for each amplification reaction. The latter assays required 45 minutes of incubation at 65 C to complete. No evidence of strain variation among phytoplasmas populations associated with sabal palms was obtained when rDNA products resulting from PCRs were evaluated by either RFLP or sequence analysis. Additional PCR assays to facilitate further study of interrelationships among sabal palm phytoplasmas, and between these stains and other palm-infecting phytoplasmas, were developed. Assays targeting genes gcp, groEL and ugpA-malK, encoding o-sialoglycoprotein endopeptidase, type-I like chaperonin and ABC transporter proteins, respectively, detected group 16SrIV phytoplasmas as well as phytoplasmas associated with coconut lethal yellowing-type diseases in East and West Africa. Collectively, RFLP or sequencing of resulting gene products were used to differentiate subgroup strains within group 16SrIV and to clearly distinguish these strains from coconut infecting phytoplasmas in Africa. However, these results failed to reveal any evidence of strain variation among subgroup 16SrIV-D strains associated with Florida sabal palms. PARTICIPANTS: Nothing significant to report during this reporting period. TARGET AUDIENCES: Nothing significant to report during this reporting period. PROJECT MODIFICATIONS: Nothing significant to report during this reporting period.
Impacts
The consistent association of phytoplasmas with a lethal decline disease affecting sabal and other palm species in west-central Florida was established thereby providing important information about the etiology of this newly emerging disease. Phytoplasmas comprise a genetically diverse group of cell wall-less bacteria that are transmitted to plants by sap-feeding insect vectors in which they colonize phloem tissues thereby causing disease. An inability to culture these pathogens, coupled with their presence in low titers in palm tissues, and lack of characteristic overt symptoms during early stages of disease development in sabal palms, places a premium upon application of DNA-based diagnostics for detection, identification and classification of these elusive plant pathogens. To address these limitations, a nested polymerase chain reaction (PCR) assay which specifically detects 16SrIV group phytoplasmas was found to dectect sabal palm-associated phytoplasmas that were identified exclusively as subgroup 16SrIV-D strains. In an attempt to reduce downstream processing and turnaround time required for sample analysis, sequence data derived from PCR assays was successfully exploited for the development of a loop-mediated isothermal amplification (LAMP) assays. Results obtained from initial applications indicate the latter assay to be equally as sensitive to nested PCRs while requiring only 45 minutes to perform. As such, the LAMP assay provides a much needed tool for attributing causality to declining palms in support of survey work to determine current incidence and distribution of disease. It is also anticipated that a LAMP assay will facilitate vector insect species identification, a prerequisite step toward predicting the future impact of this new disease on the ecology of native sabal palms in Florida and elsewhere in the southeastern USA.
Publications
- Dickinson, M., Dollet, M. and N. Harrison, 2010. Taxonomy of phytoplasmas associated with coconut lethal yellowing-type diseases. Page 245, In: Proceedings of the 18th Congress of the International Organization for Mycoplasmology, July 11-16th Chianciano Term, Italy.
- Harrison, N.A. and M. E. Elliott. 2010. Caring for palms should Texas Phoenix palm decline appear in your community. Florida Arborist, Winter Edition 13 (4) 1-8.
- Harrison, N. A. and M. L. Elliott. 2010. Texas Phoenix palm decline. Pages 26-28, In: Sun Coast Facilities Today, August edition.
- Ntushelo, K., Harrison, N., Helmick, E., Myrie, W. and C. Oropeza. 2010. Characterization of phytoplasmas associated with a new lethal decline disease of Sabal palmetto. Page 201, In: Proceedings of the 18th Congress of the International Organization for Mycoplasmology, July 11-16th Chianciano Term, Italy.
|